miRNA-17-5p target prediction and its role in senescence mechanism through p21 interference

BACKGROUND: Cellular senescence is known to be correlated with the cessation of cell cycle. The progression of cell cycle is promoted by activities of various proteins, including cyclin-dependent kinase (CDK) and cyclin proteins, which work synergistically. CDK-cyclin complexes are influenced by other proteins, such as retinoblastoma (Rb) and E2F proteins. In cell cycle, both Rb and E2F proteins could be affected by one of the CDK inhibitors, that is, p21. MicroRNA (miRNA) is well known for its role in biological processes, including cell cycle. However, the contribution of miRNA in cell cycle is still poorly understood. Some miRNAs play a role in pro-proliferation and anti-proliferation. AIM: This study was performed an in silico study analysis to reveal the relationship between miRNA-17-5p and p21 in the process of cellular senescence. METHODS: The extensive data mining was conducted to determine the miRNA that contributes to the process of anti-aging prevention and the desired target genes through the Human Protein Atlas and cancer database. miRNA target prediction was performed using DIANA-microT-CDS. Gene function of the miRNA-17-5p target was annotated using DAVID GO. RESULTS: The sequence of hsa-miRNA-17-5p (CAAAGUGCUUACAGUGCAGGUAG) has three attachment sites with binding types of 8 mer, 6 mer, and 8 mer at the transcription sites of 447–474, 485–513, and 1132–1154, respectively. The main profile of hsa-miRNA-17-5p showed that it bound to 3’-untranslated region and the coding region (exon). CONCLUSIONS: The miRNA-17-5p was involved in cellular senescence by influencing the process of cell proliferation in the cell cycle pathway.